Human STK25 knockout cell line 10bp deletion

Technical Data

Parental Cell Line

HAP1

Adherent Suspension

Adherent

Gene ID NCBI

10494

Genomic Location

chr2:241500766

Genome Assembly

hg38

General Information

Organism

Homo sapiens

Storage

LN vapor (less than -130°C)

Cell Line Characteristics

HGNC Symbol

STK25

Expression Level

168.61 TPM

The TPM expression value indicates this gene is

expressed

Guide RNA Sequence

ATGGATCATCATGGAGTACC

Targeted Transcript

NM_006374

Targeted Region

Exon 4

Mutation

10bp deletion

Transcript Plot Name

Quality Control

PCR FWD

TCCTAATTAACACCTAACGTGCCAT

PCR BWD

CTCTTGCTGCCAAATGCTGATG

Sequencing Primer

TCCTAATTAACACCTAACGTGCCAT

Sequencing Result

CCcnTGAGTCTGAgGGGCAGGGGAcTCGGACACTGCATGACCCCCCACTGCCATGGCCTATGCCTCACCAAGTCCAGTGCTGAGCCGCCGCCCAGGTGATCCATAGCTTGGTGCTCTGGGACCGAAGACAAACCCATCAGCATTTGGCAGCAAGAG

Genotype

STK25 HAP1 knockout

Cell Culture

Biosafety Level

1

Media Type

IMDM, 10% FCS

Freeze Medium

IMDM, 20% FCS, 10% DMSO

Revival

Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 ml of pre-warmed media in a 10cm dish.

Growth Properties

Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.

Documents & Related Literature

Datasheet

PDF Download

View our collection of frequently asked questions below.

FAQ

How are Hap1 knockout cell lines generated?

HAP1 knockouts are engineered using the CRISPR-Cas9 system to introduce frameshift mutations into the coding sequence of genes of interest.

What type of cells are HAP1 cells?

HAP1 is a near-haploid human cell line that was derived from the male chronic myelogenous leukemia (CML) cell line KBM-7 (see Carette  et al. Nature. 2011.). HAP1 cells are adherent with fibroblast-like morphology.

View our overview for more information on HAP1 cells

How are HAP1 knockouts validated?

All HAP1 knockout cell lines are validated by PCR amplification and Sanger Sequencing to confirm the mutation at the genomic level. To enable you to verify our results, we provide our sequencing result, including primer sequences.

Further to this HAP1 wild-type cells have been extensively characterized by whole genome sequencing and transcriptome analysis.

How do you culture HAP1 cells?

HAP1 cells are grown in Iscove’s Modified Dulbecco’s Medium (IMDM) in the presence of 10% fetal calf serum and penicillin/ streptomycin. Cells are passaged every 48h at a dilution of 1:10 or 1:20, depending on the initial density. More detailed information is available here.

Additionally, this information is listed on the Certificate of Analysis for the cell line.

What will I receive when I order a HAP1 knockout cell line?

Customers obtain a clonal HAP1 cell line, bearing a frameshift mutation in an exon of the gene of interest. Typically, the mutation is placed closed to the 5’end of the gene, ie. in exon 1 or 2.

The mutation is described in the clone datasheet enclosed upon shipment and can be verified by a PCR on genomic DNA followed by Sanger sequencing.
All mutant cell lines are provided as an isogenic pair with the wild type line. This provides a control for your downstream experiments

How do you know that HAP1 knockout cells don’t contain off-target modifications?

While we cannot exclude entirely the possibility of off target modifications in addition to on target cleavage, we believe it represents a relatively low and controllable risk, as a number of recent publications have demonstrated that the CRISPR-Cas9 system is to be highly specific (e.g. Cencic et al).

Further to this a collaborator group have published a paper where they examine off-targets in the HAP1 cell line and observe very low frequencies.

At Horizon, to mitigate the risk still further our in-house selection algorithms warrant that only those guide RNAs with minimal predicted off-target sites in the human genome are chosen. Further to this, scientists can control their experiments through the use of multiple, independent clones or rescue of the knockout with a wild-type cDNA.

I have never worked with HAP1 cells before.  How do I know if they look correct?

Our Technical Support team is happy to provide a visual inspection of your culture if you send an image to technical@horizondiscovery.com.

In addition, further information and example images can be found in our HAP1 Cell Culture Guidelines.

Why are there multiple HAP1 cell lines listed for my gene of interest?

When we perform the CRISPR gene editing, we often isolate multiple clones with successful frameshifts. The differences between them is often the number of bases that are inserted or deleted.

If you click on the product pages for each of the clones and scroll down the page, there is a pdf link with the datasheets attached. This describes the location of the frameshift and you can then determine which is more suitable for your needs.

Are HAP1 cell lines genetically stable (i.e. do they stay haploid)?

We have observed that haploid cell lines will spontaneously diploidise over time. If a gene has been knocked out, diploidisation will not affect knockout status, but to minimise the potential impact of diploidisation one of the following approaches is recommended:

• Work with cells at very low passage. Prepare stocks of low passage cells and revive frequently.
• Culture knockout and wild type cells in parallel and allow genomes to stabilise. Then use these high passage cells for experimental analyses.

How do I know if HAP1 cells are suitable for my studying a particular biological pathway?

Please contact us to discuss your experimental needs – internal research projects with this cell line are ongoing and we may have data we can share.

If you would like to learn more about our products then please browse our dedicated HAP1 FAQ here

Please see our terms and conditions of ordering.

Order Information

We accept orders using the following methods:

Online: 

Our online catalog and ordering system can be used to search our full menu of available Cell Lines. Select your desired products and add them to the shopping basket. Your order can be submitted instantly using credit card, telephone ordering or a purchase order number as the preferred payment method.

Offline:

If you prefer to send us orders outside our online ordering system, please see the Contact Us page for telephone, fax, and email details in order to place an order.  We recommend that you use our online system to identify the products you require and their respective product codes. To order offline we will require the following information:

• Product code(s) of the item(s) you wish to order (e.g. "HD123")
• Your name, email address, title and organization
• Shipping address and billing address with contact names
• Purchase Order number if you have one
• Telephone number
• VAT Number (European Countries only)

Shipping Information

We aim to ship your order direct within 5 business days of receipt of your order and we will notify you of your expected delivery date. We ship direct to the following territories:

Territory	Price (USD)	Price (EUR)	Price (GBP)	Service
US & Canada	$200			FEDEX International Priority
EU Countries (Excluding Italy)	$130	€99.00	£85.00	FEDEX International Priority
Rest of the World (Excluding Japan, Israel, Hong Kong)	$340			FEDEX International Priority

It is possible to use your own FEDEX account for shipment of goods and we will apply a small fee ($5.00 / £5.00 / €5.00) to cover packaging costs.

If you’re having trouble ordering or finding what you’re looking for, or if you require something we don’t yet offer, please see below for more information: 

Contact Us Terms of Ordering