Human HIPK3 knockout cell line 2bp deletion

Gene Synonyms
DYRK6, FIST3, PKY, YAK1

Description
HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of HIPK3.

This product includes the following:
• Genetically modified cell line
• Matched control
HZGHC000334c012
Academic
Commercial
$5,950.00

Availability: In stock

Within 7 business days

Bulk order discount
  • Highly characterized clonal human cell lines
  • Strong IP position, supporting your freedom to operate
  • Wild type cell line included as a control
OR
Technical Information

Technical Data

Parental Cell Line
HAP1
Adherent Suspension
Adherent
Gene ID NCBI
10114
Genomic Location
chr11:33286721
Genome Assembly
hg38

General Information

Organism
Homo sapiens
Storage
LN vapor (less than -130°C)

Cell Line Characteristics

HGNC Symbol

HIPK3

Expression Level
8.48 TPM
The TPM expression value indicates this gene is
expressed
Guide RNA Sequence
CACGTGCAGGCACCTCAGAT
Targeted Transcript
NM_001048200
Targeted Region
Exon 2
Mutation
2bp deletion
Transcript Plot Name

Quality Control

PCR FWD
GTGTGAAGAAACTCAAAGTAGAGCC
PCR BWD
AGGAAGTATGGACAATTCATCGACA
Sequencing Primer
GTGTGAAGAAACTCAAAGTAGAGCC
Sequencing Result
AACTATCcnCGGACCTATGTGAAtGGTAGAAACTTTGGAAATTCTCATCCTCCCACTAAGGGTAGTGCTTTTCAGACAAAGATACCATTTAATAGACCTCGAGGACACAACTTTTCATTGCAGACAAGTGCTGTTGTTTTGAAAAACACTGCAGGTGCTACAAAGGTCATAGCAGCTCAGGCACAGCAAGCTCACGTGCAGGCACCTCATTGGGGCGTGGCGAAACAGATTGCATTTCCTAGAAGGCCCCCAGCGATGTGGATTGAAGCGCAAGAGTGAGGAGTTGGATAATCATAGCAGCGCAATGCAGATTGTCGATGAATTGTCcatACTtc
Genotype
HIPK3 HAP1 knockout

Cell Culture

Biosafety Level
1
Media Type
IMDM, 10% FCS
Freeze Medium
IMDM, 20% FCS, 10% DMSO
Revival
Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 ml of pre-warmed media in a 10cm dish.
Growth Properties
Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Protocols & Documents

Documents & Related Literature

Datasheet
PDF Download
Order & Delivery Information

Please see our terms and conditions of ordering.

If you need any support, advice or additional documentation then don't hesitate to contact us here.

Order Information

We accept orders using the following methods:

Online: 

Our online catalog and ordering system can be used to search our full menu of available Cell Lines. Select your desired products and add them to the shopping basket. Your order can be submitted instantly using credit card, telephone ordering or a purchase order number as the preferred payment method.

Offline:

If you prefer to send us orders outside our online ordering system, please see the Contact Us page for telephone, fax, and email details in order to place an order.  We recommend that you use our online system to identify the products you require and their respective product codes. To order offline we will require the following information:

  • Product code(s) of the item(s) you wish to order (e.g. "HD123")
  • Your name, email address, title and organization
  • Shipping address and billing address with contact names
  • Purchase Order number if you have one
  • Telephone number
  • VAT Number (European Countries only)

Shipping Information

We aim to ship your order direct within 5 business days of receipt of your order and we will notify you of your expected delivery date. We ship direct to the following territories:

TerritoryPrice (USD)Price (EUR)
Price (GBP)Service

US & Canada

$200

 

 

FEDEX International Priority

EU Countries
(Excluding Italy)

$130

€99.00

£85.00

FEDEX International Priority

Rest of the World
(Excluding Japan, Israel, Hong Kong) 

$340

  

 

FEDEX International Priority

It is possible to use your own FEDEX account for shipment of goods and we will apply a small fee ($5.00 / £5.00 / €5.00) to cover packaging costs.

If you’re having trouble ordering or finding what you’re looking for, or if you require something we don’t yet offer, please see below for more information: 

Contact Us Terms of Ordering

Reviews

Write Your Own Review

You're reviewing: Human HIPK3 knockout cell line 2bp deletion

How do you rate this product? *

 
1 1 star
2 2 star
3 3 star
4 4 star
5 5 star
Quality
Price
Value
Back to top