EGFR Wild Type Reference Standard

Synonyms
ERBB, ERBB1

Format
Genomic DNA

Description
The EGFR Wild Type Reference Standard is a highly-characterized, biologically-relevant quality control material used to assess the performance of assays that detect somatic mutations, such as Sanger and qPCR sequencing assays.

With this product you are able to:
• Analyze the sensitivity of your assay
• Gain certainty of the limit of detection
• Optimize and validate new cancer panels and routinely monitor the performance of your assay
HD709
$135.00

Availability: In stock

Dispatched within 24 hours

Bulk order discount
OR
Technical Information
Horizon DNA standards eliminate the variability associated with patient-derived reference standards, and avoid the hassle of sourcing, characterizing, and documenting your own cell line mixes. The standard is provided at an allelic frequency of 50%, and may be diluted using the corresponding wild-type standard to generate a lower allelic frequencies for limit of detection studies.

Horizon’s Base-Seq products are all derived from human cell lines, and are high molecular weight DNA. This format ensures that they may be applied to a wide-range of assays including qPCR, Sanger sequencing, next-generation sequencing, mass array, and more.

Technical Data

Buffer
Tris-EDTA (10mM Tris-HCl, 1mM EDTA), pH 8.19

Product Information

Intended Use
For routine performance monitoring (Research Use Only)
Unit Size
5µg
Concentration
50ng/µl

General Information

Allelic Frequency
100%
Storage
4˚C
Expiry
36 months from the date of manufacture
Cell Line Background

RKO

Quality Control

Allelic Frequency
Droplet Digital PCR™
Genotype
Sanger sequencing of locus specific PCR
Quality
Agarose gel electrophoresis
Quantification
Spectrophotometry (A260)
Genotype
EGFR (+/+)

Characterization

Gel Image
EGFR Wild Type Reference Standard - Gel Image
DNA was run on a 1% agarose gel and shows a single high-molecular weight band
Primers
PrimerSequenceSize
ForwardGCTGAGGTGACCCTTGTCTC408
ReverseGTCAATGGCCCCTTTCATAA
SequencingGCTGAGGTGACCCTTGTCTC--


For Sanger sequencing of EGFR T790 we use the following primer set:

PrimerSequenceSize
ForwardCATTCATGCGTCTTCACCTG313
ReverseTTATCTCCCCTCCCCGTATC
SequencingCATTCATGCGTCTTCACCTG--


For Sanger sequencing of EGFR E746 - A750 we use the following primer set:

PrimerSequenceSize
ForwardGCTGGTAACATCCACCCAGA225
ReverseTGGTCAGTTTGGAGCAAATG
SequencingGCTGGTAACATCCACCCAGA--


For Sanger sequencing of EGFR L858 we use the following primer set:

PrimerSequenceSize
ForwardCTCAGAGCCTGGCATGAAC346
ReverseATCCTCCCCTGCATGTGTTA
SequencingCTCAGAGCCTGGCATGAAC--


For Sanger sequencing of EGFR L861 we use the following primer set:

PrimerSequenceSize
ForwardCATTCATGCGTCTTCACCTG346
ReverseATCCTCCCCTGCATGTGTTA
SequencingCTCAGAGCCTGGCATGAAC--
Protocols & Documents

Please browse our collection of downloads below.

If you need any support, advice or additional documentation then don't hesitate to contact us here.

Certificate of Analysis

Batch ID: gDNA-wildtype
PDF Download
Batch ID: 34214
PDF Download

Documents & Related Literature

Safety Data Sheet
PDF Download
Order & Delivery Information

Please see our terms and conditions of ordering.

If you need any support, advice or additional documentation then don't hesitate to contact us here.

Order Information

We accept orders using the following methods:

Online: 

Our online catalog and ordering system can be used to search our full menu of available HDx™ Reference Standards. Select your desired reference standards and add them to the shopping basket. Your order can be submitted instantly using credit card, telephone ordering or a purchase order number as the preferred payment method.

Offline:

If you prefer to send us orders outside our online ordering system, please see the Contact Us page for telephone, fax, and email details in order to place an order.  We recommend that you use our online system to identify the products you require and their respective “HD” product codes. To order offline we will require the following information:

  • Product code(s) of the item(s) you wish to order (e.g. "HD123")
  • Your name, email address, title and organization
  • Shipping address and billing address with contact names
  • Purchase Order number if you have one
  • Telephone number
  • VAT Number (European Countries only)

Shipping Information

Shipping information for all territories can be found on our Shipping Charges page. This includes Shipping and Handling fees, as well as shipping conditions for each product range.

If you’re having trouble ordering or finding what you’re looking for, or if you require something we don’t yet offer, please see below for more information: 

Contact Us Terms of Ordering

Reviews

Write Your Own Review

You're reviewing: EGFR Wild Type Reference Standard

How do you rate this product? *

 
1 1 star
2 2 star
3 3 star
4 4 star
5 5 star
Quality
Price
Value
Back to top