AKT1 Wild Type Reference Standard

Synonyms
AKT, PKB, PRKBA, RAC

Format
Genomic DNA

Description
The AKT1 Wild Type Reference Standard is a highly-characterized, biologically-relevant quality control material used to assess the performance of assays that detect somatic mutations, such as Sanger and qPCR sequencing assays.

With this product you are able to:
• Analyze the sensitivity of your assay
• Gain certainty of the limit of detection
• Optimize and validate new cancer panels and routinely monitor the performance of your assay

5% discount on online orders

Use 'ONLINE5'. *Terms apply

 
Catalog ID
Qty
Unit Price
HD659
$120.00
Bulk order discount

Availability: In stock

Dispatched within 24 hours

Total:
OR
Technical Information
Horizon DNA standards eliminate the variability associated with patient-derived reference standards, and avoid the hassle of sourcing, characterizing, and documenting your own cell line mixes. The standard is provided at an allelic frequency of 50%, and may be diluted using the corresponding wild-type standard to generate a lower allelic frequencies for limit of detection studies.

Horizon’s Base-Seq products are all derived from human cell lines, and are high molecular weight DNA. This format ensures that they may be applied to a wide-range of assays including qPCR, Sanger sequencing, next-generation sequencing, mass array, and more.

Technical Data

Buffer
Tris-EDTA (10mM Tris-HCl, 1mM EDTA), pH 8.2

Product Information

Intended Use
For routine performance monitoring (Research Use Only)
Unit Size
5µg
Concentration
50ng/µl

General Information

Allelic Frequency
100%
Storage
4˚C
Expiry
24 months from the date of manufacture
Cell Line Background

MCF10A

Quality Control

Allelic Frequency
Droplet Digital PCR™
Genotype
Sanger sequencing of locus specific PCR
Quality
Agarose gel electrophoresis, Quantitatitive PCR of GAPDH locus
Quantification
Spectrophotometry (A260)
Genotype
AKT1 (+/+)

Characterization

Gel Image
AKT1 Wild Type Reference Standard - Gel Image
DNA was run on a 1% agarose gel and shows a single high-molecular weight band
Chromatogram
AKT1 Wild Type Reference Standard - Chromatogram
Chromatograph showing heterozygosity for the AKT1 E17K mutant sample and homozygous normal for the AKT1 E17 wild type
Primers
PrimerSequenceSize
ForwardGCCTCCTGTCCATGGTACTC1198
ReverseGAGGGGAAGCAAAGGCTCTG
SequencingGCGCCACAGAGAAGTTGTTG--
Protocols & Documents

Please browse our collection of downloads below.

If you need any support, advice or additional documentation then don't hesitate to contact us here.

Certificate of Analysis

Batch ID: 11298
PDF Download
Batch ID: 14837
PDF Download
Batch ID: 25573
PDF Download

Documents & Related Literature

Product Specification
PDF Download
Safety Data Sheet
PDF Download
Order & Delivery Information

Please see our terms and conditions of ordering.

If you need any support, advice or additional documentation then don't hesitate to contact us here.

Order Information

We accept orders using the following methods:

Online: 

Our online catalog and ordering system can be used to search our full menu of available HDx™ Reference Standards. Select your desired reference standards and add them to the shopping basket. Your order can be submitted instantly using credit card, telephone ordering or a purchase order number as the preferred payment method.

Offline:

If you prefer to send us orders outside our online ordering system, please see the Contact Us page for telephone, fax, and email details in order to place an order.  We recommend that you use our online system to identify the products you require and their respective “HD” product codes. To order offline we will require the following information:

  • Product code(s) of the item(s) you wish to order (e.g. "HD123")
  • Your name, email address, title and organization
  • Shipping address and billing address with contact names
  • Purchase Order number if you have one
  • Telephone number
  • VAT Number (European Countries only)

Shipping Information

We aim to ship your order direct within 5 business days of receipt of your order and we will notify you of your expected delivery date. We ship direct to the following territories:

TerritoryPrice (Room Temperature)Price (4°C)Service

US & Canada

$25.00

$45.00

FEDEX International Priority

EU Countries
(Excluding Italy)

€20.00

€36.00

FEDEX International Priority

UK

£18.00

£32.40

Royal Mail Recorded Signed For™

Rest of the World
(Excluding Japan, Israel, Hong Kong) 

 

$25.00 - $80.00

 

$45.00 - $120.00

 

FEDEX International Priority

 

We have selected Room Temperature as the most appropriate shipping condition to ensure the stability of our HDx DNA and FFPE Reference Standards and 4°C for our HDx FISH Reference Standards during transit.

It is possible to use your own FEDEX account for shipment of goods and we will apply a small fee ($5.00 / £5.00 / €5.00) to cover packaging costs for Room Temperature Shipments and ($25.00 / €20.00 / £18.00) for Dry Ice Shipments. 

If you’re having trouble ordering or finding what you’re looking for, or if you require something we don’t yet offer, please see below for more information: 

Contact Us Terms of Ordering

Back to top