Human SQSTM1 knockout cell line 4bp deletion

Gene Synonyms
A170, OSIL, p60, p62, p62B, PDB3, ZIP3

Description
HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of SQSTM1.

This product includes the following:
• Genetically modified cell line
• Matched control

5% discount on online orders

Use 'ONLINE5'. *Terms apply

 
Catalog ID
Qty
Unit Price
HZGHC000298c015
$1,450.00

Academic pricing applied

Bulk order discount

Availability: In stock

Within 7 business days

Total:

Commercial pricing Please contact us or call 1-844-655-7800

OR
Technical Information

Technical Data

Parental Cell Line
HAP1
Adherent Suspension
Adherent
Gene ID NCBI
8878
Genomic Location
chr5:179823923
Genome Assembly
hg38

General Information

Organism
Homo sapiens
Storage
LN vapor (less than -130°C)

Cell Line Characteristics

HGNC Symbol

SQSTM1

Expression Level
124.45 TPM
Guide RNA Sequence
CACCCCAATGTGATCTGCGA
Targeted Transcript
NM_003900
Targeted Region
Exon 3
Mutation
4bp deletion
Transcript Plot Name

Quality Control

PCR FWD
CTAAGTGGCTGAATTTTGTGTGGAT
PCR BWD
GAATGCGAGCTTGGTGTGC
Sequencing Primer
CTAAGTGGCTGAATTTTGTGTGGAT
Sequencing Result
CACCGCCCANCGTGTGCTCAGGAGGCGCCCCGCANCATGGNGCACCCCNATGTGATCTGGGNTGCAATGGGNCTGTGGTAGGAACCCGCTACAAGTGCAGCGTCTGCCCAGACTACGACT
Genotype
SQSTM1 HAP1 knockout

Cell Culture

Biosafety Level
1
Media Type
IMDM, 10% FCS
Freeze Medium
IMDM, 20% FCS, 10% DMSO
Revival
Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 ml of pre-warmed media in a 10cm dish.
Growth Properties
Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Protocols & Documents

Documents & Related Literature

Datasheet
PDF Download
Order & Delivery Information

Please see our terms and conditions of ordering.

If you need any support, advice or additional documentation then don't hesitate to contact us here.

Order Information

We accept orders using the following methods:

Online: 

Our online catalog and ordering system can be used to search our full menu of available Cell Lines. Select your desired products and add them to the shopping basket. Your order can be submitted instantly using credit card, telephone ordering or a purchase order number as the preferred payment method.

Offline:

If you prefer to send us orders outside our online ordering system, please see the Contact Us page for telephone, fax, and email details in order to place an order.  We recommend that you use our online system to identify the products you require and their respective product codes. To order offline we will require the following information:

  • Product code(s) of the item(s) you wish to order (e.g. "HD123")
  • Your name, email address, title and organization
  • Shipping address and billing address with contact names
  • Purchase Order number if you have one
  • Telephone number
  • VAT Number (European Countries only)

Shipping Information

We aim to ship your order direct within 5 business days of receipt of your order and we will notify you of your expected delivery date. We ship direct to the following territories:

TerritoryPrice (USD)Price (EUR)
Price (GBP)Service

US & Canada

$200

 

 

FEDEX International Priority

EU Countries
(Excluding Italy)

$130

€99.00

£85.00

FEDEX International Priority

Rest of the World
(Excluding Japan, Israel, Hong Kong) 

$340

  

 

FEDEX International Priority

It is possible to use your own FEDEX account for shipment of goods and we will apply a small fee ($5.00 / £5.00 / €5.00) to cover packaging costs.

If you’re having trouble ordering or finding what you’re looking for, or if you require something we don’t yet offer, please see below for more information: 

Contact Us Terms of Ordering

Back to top