Human DCLK1 knockout cell line 1bp insertion

Gene Synonyms
CL1, CLICK1, DCAMKL1, DCDC3A, DCLK

Description
HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of DCLK1.

This product includes the following:
• Genetically modified cell line
• Matched control
HZGHC000226c005

Availability: In stock

Within 7 business days

Bulk order discount
If you want to place an order, please contact our distributor
OR
Technical Information

Technical Data

Parental Cell Line
HAP1
Adherent Suspension
Adherent
Gene ID NCBI
9201
Genomic Location
chr13:35854539
Genome Assembly
hg38

General Information

Organism
Homo sapiens
Storage
LN vapor (less than -130°C)

Cell Line Characteristics

HGNC Symbol

DCLK1

Expression Level
9.72 TPM
The TPM expression value indicates this gene is
expressed
Guide RNA Sequence
CTTGGCGACTTGCCTGAGCG
Targeted Transcript
NM_004734
Targeted Region
Exon 6
Mutation
1bp insertion
Transcript Plot Name

Quality Control

PCR FWD
CTCCTGTTCTAGCTTAGATATCGCC
PCR BWD
TACAAAACTGTGACTCTCTGAAGGT
Sequencing Primer
CTCCTGTTCTAGCTTAGATATCGCC
Sequencing Result
ttGcTGGcaCCTGTACCTGTCTGCaCCaAGGTTGAGACAGGTCTGAAACAAGCAGCTTGCTTATTTCCTTACCCTCTGCTTCCGCAGGCTTCCTGGGCTGGTGGGTGATGGGCTTGGCGACTTGCCTGAAGCGCGGAGTAGAGAGCTGACTACCAGGGGTTCCATTAACTAGAAATACAAAGAATCACACACAGAGAAAAATGGCACGTTAAATAATTTTCATGACAAATCATCTTCTGCAAGAAATAAACAATTATATAGAGAGCCATCTACTAGAACTCTAGACACCCTTCCATATGTACACTGAGGAACAGCTTTGGGGAAGTAACCTTCAGAGA
Genotype
DCLK1 HAP1 knockout

Cell Culture

Biosafety Level
1
Media Type
IMDM, 10% FCS
Freeze Medium
IMDM, 20% FCS, 10% DMSO
Revival
Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 ml of pre-warmed media in a 10cm dish.
Growth Properties
Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Protocols & Documents

Documents & Related Literature

Datasheet
PDF Download
Order & Delivery Information
If you want to place an order, please contact our distributor
Reviews

Write Your Own Review

You're reviewing: Human DCLK1 knockout cell line 1bp insertion

How do you rate this product? *

 
1 1 star
2 2 star
3 3 star
4 4 star
5 5 star
Quality
Price
Value
Back to top