Guide RNA vector for human RNF2

Description
Guide RNA vector for human RNF2.

Please be advised this product can only be used with the related cell line.
HZGGA001181
$300.00

Availability: In stock

Within 7 business days

Bulk order discount
OR
Technical Information

Technical Data

Local Region in Vector
TGTACAAAAAAGCAGGCTTTAAAGGAACCAATTCAGTCGACTGGATCCGGTACCAAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCAATTCACTGTGTAGACTTCGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT

Product Information

Unit Size
1500 ng
Concentration
150 ng/yl

General Information

Storage
4C

Cell Line Characteristics

Guide RNA Sequence
AATTCACTGTGTAGACTTCG
Order & Delivery Information

Please see our terms and conditions of ordering.

If you need any support, advice or additional documentation then don't hesitate to contact us here.

Order Information

We accept orders using the following methods:

Online: 

Our online catalog and ordering system can be used to search our full menu of available HDx™ Reference Standards. Select your desired reference standards and add them to the shopping basket. Your order can be submitted instantly using credit card, telephone ordering or a purchase order number as the preferred payment method.

Offline:

If you prefer to send us orders outside our online ordering system, please see the Contact Us page for telephone, fax, and email details in order to place an order.  We recommend that you use our online system to identify the products you require and their respective “HD” product codes. To order offline we will require the following information:

  • Product code(s) of the item(s) you wish to order (e.g. "HD123")
  • Your name, email address, title and organization
  • Shipping address and billing address with contact names
  • Purchase Order number if you have one
  • Telephone number
  • VAT Number (European Countries only)

Shipping Information

Shipping information for all territories can be found on our Shipping Charges page. This includes Shipping and Handling fees, as well as shipping conditions for each product range.

If you’re having trouble ordering or finding what you’re looking for, or if you require something we don’t yet offer, please see below for more information: 

Contact Us Terms of Ordering

Reviews

Write Your Own Review

You're reviewing: Guide RNA vector for human RNF2

How do you rate this product? *

 
1 1 star
2 2 star
3 3 star
4 4 star
5 5 star
Value
Quality
Price
Back to top