Guide RNA vector for human MGMT

Description
Guide RNA vector for human MGMT.

Please be advised this product can only be used with the related cell line.
Catalog ID
Qty
Unit Price
HZGGA000430
$300.00
Bulk order discount

Availability: In stock

Within 7 business days

Total:
OR
Technical Information

Technical Data

Local Region in Vector
TGTACAAAAAAGCAGGCTTTAAAGGAACCAATTCAGTCGACTGGATCCGGTACCAAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCCTGCACGAAATAAAGCTCCTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT

Product Information

Unit Size
1500 ng
Concentration
150 ng/yl

General Information

Storage
4C

Cell Line Characteristics

Guide RNA Sequence
CTGCACGAAATAAAGCTCCT
Order & Delivery Information

Please see our terms and conditions of ordering.

If you need any support, advice or additional documentation then don't hesitate to contact us here.

Order Information

We accept orders using the following methods:

Online: 

Our online catalog and ordering system can be used to search our full menu of available Cell Lines. Select your desired products and add them to the shopping basket. Your order can be submitted instantly using credit card, telephone ordering or a purchase order number as the preferred payment method.

Offline:

If you prefer to send us orders outside our online ordering system, please see the Contact Us page for telephone, fax, and email details in order to place an order.  We recommend that you use our online system to identify the products you require and their respective product codes. To order offline we will require the following information:

  • Product code(s) of the item(s) you wish to order (e.g. "HD123")
  • Your name, email address, title and organization
  • Shipping address and billing address with contact names
  • Purchase Order number if you have one
  • Telephone number
  • VAT Number (European Countries only)

Shipping Information

We aim to ship your order direct within 5 business days of receipt of your order and we will notify you of your expected delivery date. We ship direct to the following territories:

TerritoryPrice (USD)Price (EUR)
Price (GBP)Service

US & Canada

$200

 

 

FEDEX International Priority

EU Countries
(Excluding Italy)

$130

€99.00

£85.00

FEDEX International Priority

Rest of the World
(Excluding Japan, Israel, Hong Kong) 

$340

  

 

FEDEX International Priority

It is possible to use your own FEDEX account for shipment of goods and we will apply a small fee ($5.00 / £5.00 / €5.00) to cover packaging costs.

If you’re having trouble ordering or finding what you’re looking for, or if you require something we don’t yet offer, please see below for more information: 

Contact Us Terms of Ordering

Back to top