Validated Guide RNAs

Cell line validated guide RNAs from Horizon are the guides that have been used to generate our Knockout HAP1 Cell Lines.

Guide RNA editing efficiency spread

The guides are designed to disrupt the gene of interest through the introduction of frameshift mutations into the coding sequence, following error prone repair of double strand breaks introduced by Cas9, a bacterial endonuclease derived from Streptococcus pyogenes that can be reprogrammed by guide RNAs to target any genomic region of interest.

Co-transfection of cells with expression plasmids for Cas9 and a suitable gRNA will induce a DNA double-strand break at that genomic location.

For HAP1 knockouts, 24 clones are screened for frameshift mutations at the target locus and successfully generated mutants validated and added to our collection.

As such, our available guide RNAs have a minimum editing efficiency of 4% in this system, although much higher efficiencies are routinely observed (see figure).

Guide RNA Plasmid Map

A guide RNA expression plasmid map

The guide RNA expression plasmid provided here contains a suitable guide RNA under the control of a human U6 promoter.

The guide RNA consists of a variable segment of 20 bases, followed by a constant portion of 76 bases that contains both elements of the crRNA and the tracrRNA.

If the gRNA sequence does not naturally start with guanine, we add a guanine to the 5’end to enable efficient expression from the U6 promoter.

Sequence information

TGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACTCACTATAGGGCGAATTGGAGCTCCCGCGGTGCGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGCCCAATGTGGAATTCGCCCTTTGTACAAAAAAGCAGGCTTTAAAGGAACCAATTCAGTCGACTGGATCCGGTACCAAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGCAGATCCTTCTTGGTAACGTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTCTAGACCCAGCTTTCTTGTACAAAGTTGGCATTAAAGGGCGAATTCCACAGTGGATATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGCCCGGTACCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGCGCGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTG

 

Suggested sequencing primer:
TAATACGACTCACTATAGG (T7)

U6 promoter

Variable part of the gRNA targeting the gene of interest

Constant part of the gRNA

Example Guide RNA information

  • Sequence: CAGATCCTTCTTGGTAACGT
  • Targeted gene: KDM3A
  • Targeted transcript: NM_018433
  • Vector information: AmpR (Ampicillin resistance)
  • Guide RNA design: Guide RNA was selected to minimize off-target cleavage potential which was assessed using a web-based tool

Validated guide RNA expression plasmids are available when purchasing. Browse our catalog for your gene of interest:

Knockout Cell Lines

Further guide RNA reading:

5 Tips For Guide RNA Design

Back to top